Expression of plant growth promoting traits of Fusariumsolani KUSF0104 under metal stressed conditions

Authors: Roushan Islam and Bejoysekhar Datta

Journal Name: Plant Science Archives

DOI: https://doi.org/10.51470/PSA.2026.11.1.115

Keywords: Fusarium, non-pathogenic, germination, vigour index, phytohormone, IAA, GA, heavy metal, agriculture etc

Abstract

The present study explores the plant growth-promoting traits of Fusarium soil isolate and also their estimation under various conditions of metal stress. Fusarium sp. was isolated from an agriculturally important soil of Murshidabad district in West Bengal, India by serial dilution plate technique on selective medium using pentachloronitrobenzene and was later identified by spore morphology and molecular study. The Fusarium sp was found to be non-pathogenic soil isolate based on increased germination percentages and vigour index values of six seed plants viz., chickpea, black gram, cucumber, chilli, mustar and paddy . The fungal isolate produced substantial amount of IAA in tryptophan-supplemented broth (370 µg/ml) and also produced GA in colossal amounts (4800 µg/ml). The Fusarium sp. could resist the tested heavy metals viz., Cd, Cu, Fe, Ni and Zn and MIC values were in the range from as low as 175 ppm (Cd) to as high as 350 ppm (Fe). The isolate produced IAA and GA in metal-contaminated broths. But, Cd at 50 ppm concentration completely inhibited both IAA and GA production. Zn at 50 ppm concentration was also found to be inhibitory to the isolate with regard to its ability to produce IAA. But GA production continued uninhibited (3500-4250 µg/ml) in the presence of the tested heavy metals at minimum (50 ppm) concentrations. Siderophore production by the isolate was found to be on the higher range (400-540 nmole/ml) in presence of Cu, Fe and Zn. Phosphate solubilisation remained unaffected (1400-1800 ppm) by the Fusarium isolate in presence of the tested heavy metals except Cd. Thus, the soil isolate could be of immense use in metal-contaminated agricultural soils to increase yields of agronomically important crops.

Download this article as

Introduction:

Heavy metals are metallic elements which have specific mass considerably higher than the normal metals in the periodic table (5 g/cm3). A number of heavy metals acts as essential micronutrients necessary for plant growth, while toxic metals like Cd, Pb, As and Hg have no significant roles in biological systems [1]. Heavy metal pollution in agricultural soils is one of the major environmental threats as the metals are not biodegradable and persist in the soil indefinitely. Filamentous fungi, such as Aspergillus, Penicillium, Fusarium, Rhizopus and Trichoderma have been reported to exhibit significant tolerance towards these toxic heavy metals, and are now known to be leading micro-organisms in metal polluted sites [2,3].

Akin to several plant growth-promoting rhizobacteria, some non-pathogenic rhizospheric fungi were reported to support plant growth upon root colonisation and were typically designated as ‘plant growth-promoting fungi’ [4]. They are potentially applied in agriculture as biofertilizer agents. They are reported to synthesise hormones such as auxin (IAA) and gibberellic acid (GA) and transport these in plants [5]. Several PGPF were reported to solubilise inorganic phosphates, making these available to the plant. They were also found to secrete siderophore under iron deficiency to meet their iron requirement and also make the iron available to the plant. Siderophore was also found to be crucial in the control of soil borne plant diseases caused by variety of pathogens with an improper iron uptake system [6].

Auxin (IAA) is one of the major plant hormones that can be synthesised by diverse soil microorganisms including fungi and bacteria. Tryptophan is the necessary precursor molecule for the biosynthesis of IAA in soil microorganisms. Root exudates of the plants release are enough tryptophan in soil. Important genes in biosynthetic pathway e.g., IaaM and IaaH genes have been identified from a number of Fusarium species [7].

There are more than 100 types of gibberellins identified in higher plants In fungi,  more  than 20 GAs have been isolated. But in bacteria, only four GAs were recovered [8]. The fungi do not use GAs for their own development but can produce and supply great quantities of this exogenous GAs to amend the response of their host and act as signalling molecules for the host plant [9]. GA production has been reported in several other species of Fusarium by number of investigators [10-12].

Under conditions of iron starvation, microorganisms compete with other iron-requiring microorganisms through hyper activation of iron uptake system. One component of the system is the siderophore which is a Fe3+ ion specific chelating agent released extracellularly by certain microorganisms present in the soil [13].

Phosphorus (P) is second most essential macronutrients required for plant growth and development. However, bulk amount of soil phosphorus is present in the insoluble form and becomes inaccessible to the plants [14]. Many soil microorganisms can efficiently release P from inorganic forms through phosphate solubilisation and subsequent mineralisation by secreting a number of organic acids [15]. A variety of organic acids viz., malic acid, fumaric acid and gluconic acids are responsible for solubilising the inorganic phosphates present in soil [16].

The present study is significant considering the exploration of several plant growth-promoting traits of Fusarium sp. under conditions of metal stress which can be subsequently proven to be effective in improving the crop yield using the metal-tolerant plant growth-promoting species of Fusarium.

Materials and Methods

Collection of soil: The soil was collected from the root region of the plant of an agricultural field located in Bamnabad village of West Bengal, India. The agricultural field was situated on banks of Padma river. The agricultural land was known for cultivation for multiple crops throughout the year. It is worth mentioning that there were no previous reports of any Fusarium diseases in the agricultural field.

Isolation and identification of Fusarium sp.: The fungus was soil isolated by the serial soil dilution plate technique on selective peptone PCNB agar medium amended with two antibiotics viz., streptomycin (1.0 g/l) and neomycin (0.10 g/l). The plates were put in incubator at 27°C for 6-7 days till a visible colony growth occurred. The Fusarium isolate was later identified considering several parameters viz., conidia production, pigment production and morphology of the colony on CDA medium. The identity of the isolate was further confirmed by molecular analysis using sequenced r-DNA. The g-DNA of the isolate was extracted and used as a template for further amplification of the r-DNA region using the primer pair ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) [17]. The amplified DNA product was sequenced and analysed using the Nucleotide BLAST at NCBI to find out homology of the sequenced DNA with the nucleotide database.

Pathogenicity test: Seeds of six different higher plants were surface sterilised using 0.1% HgCl2 solution for 45 sec. and washed three times with sterile water. 10 surface sterilised seeds of each plant were put into the culture filtrate of the Fusarium isolate separately and were kept at 8°C for an 12 hours. The seeds were plated on sterile wet blotting paper kept within the petri dish on the following day. After 5-7 days, root-shoot lengths and the % of seed germination were calculated. Vigour index of the individual seed was also considered by using the standard formula.

Metal tolerance test: The tolerance to the five different heavy metals viz., Cd, Cu, Fe, Ni and Zn was tested in the broth medium. Different sets of PD broth were prepared and supplemented with increasing concentrations of individual heavy metals. A control broth without metal was also prepared. Each broth was inoculated with 5mm diameter of mycelia disc from a week old pure culture of the isolate and incubated at 27°C for 14 days. Mycelial dry weights of the isolate were measured after the incubation period. Tolerance was estimated observing the minimum inhibitory concentration (MIC) and tolerance index (TI) [18,19].

Effect of heavy metals on IAA production: The Fusarium isolate was evaluated for IAA production in the presence of different heavy metals viz., cadmium (Cd), copper (Cu), iron (Fe), nickel (Ni) and zinc (Zn). Freshly prepared CD broths were supplemented with minimum concentration (50 ppm) of the individual heavy metals and 1000 ppm tryptophan. After inoculation in the broth medium and subsequent incubation at 27ºC for 2 weeks, the production of IAA was estimated by spectrophotometric method using Salkowski’s regent.

Effect of heavy metals on GA production: The GA producing Fusarium isolate was evaluated with regard to its GA production in the presence of different heavy metals viz., cadmium (Cd), copper (Cu), iron (Fe), nickel (Ni) and zinc (Zn). Freshly prepared CD broths were supplemented with minimum concentration (50 ppm) of the individual heavy metals. After inoculation in the broth medium and subsequent incubation at 27ºC for 2 weeks, the production of GA was estimated by spectrophotometric method using phosphomolybdic acid regent.

Effect of heavy metals on siderophore production: The soil isolate was also tested for production of the iron chelator- siderophore in the presence of different heavy metals viz., cadmium (Cd), copper (Cu), iron (Fe), nickel (Ni) and zinc (Zn). Sets of CD broths were made and supplemented with minimum concentration (50 ppm) of the individual heavy metal. The Fusarium isolate were inoculated into the broths and incubated at 27ºC for 2 weeks. Estimation of siderophore produced in different broths was done by spectrophotometric method using the CAS reagent.

Effect of heavy metals on phosphate solubilisation: TheMetal-tolerant Fusarium isolate was evaluated for its potential to solubilise inorganic phosphate in metal contaminated broth medium. Different sets of Pikovskaya’s broths were prepared and supplemented with the minimum concentration (50 ppm) of the individual heavy metals viz., Cd, Cu, Fe, Ni and Zn. The Fusarium isolate was inoculated in the broths and incubated at 27ºC for 2 weeks. Amount of soluble phosphate in the filtrate was finally estimated spectrophotometrically using molybdate vanadate reagent.

Ammonia production under heavy metal stress: Freshly grown Fusarium culture was inoculated in 25 ml of peptone water supplemented with heavy metals, viz., Cu, Cu, Fe, Ni, Zn at 50 ppm concentration each and incubated at 27°C for 1 week. 10 ml of the culture filtrate was mixed with 0.5 ml Nessler’s reagent. Uninoculated peptone water treated with Nessler’s reagent was kept as control. Development of yellow to brown colour was considered a positive result for ammonia production [20].

Results and Discussion

Isolation and identification of the Fusarium sp.: On PCNB medium, the fungal isolate appeared was definitely Fusarium, with all its characteristic growth and morphology of the colony. The isolate was designated as KUSF0104. On CDA medium the soil isolate showed circular, white, smooth, dense and fast-growing colony with ventral surface turned dark brown at later days of incubation (Fig. 1). It produced macroconidia in abundance which were falcate having certain degree of curvature; number of septa varied between 3-5 (Fig. 1). Microconidia were ellipsoid to fusiform; with no. of septa varied between 0-1 (Fig. 1).  Chlamydospores were abundant. They were intercalary or terminal in aerial mycelia, produced singly, in pair, in chains and in clusters, spherical (10-15.5 µm in diameter), verrucose (Fig. 1).

Molecular identification of the fungal isolate KUSF0104 was carried out by sequence homology through nucleotide BLAST in NCBI database. Maximum similarity (99%) was matched with the r-DNA sequence of F. Solani Zbf-R4 (99%) (KX079482). The fungal isolate was eventually recognized as Fusarium solani. The r-DNA sequence of the Fusarium isolate KUSF0104 was deposied to the gene bank under the accession no. MF136400.

Pathogenicity test: Results of the pathogenicity test have been shown in table 1. Most of the seeds germinated and the percentage of seed germination was variable in different plants. Culture filtrate of the Fusarium isolateKUSF0104 (MF136400) was not inhibitory with respect to germination of the seeds which eventually proved the fact that the isolate was non-pathogenic. In addition, growth stimulatory effects of the culture filtrate of the Fusarium isolate on at least three plants were evident in the results (Table 1, Fig. 2). Early onset of seed germination was also found in some of the inoculated seeds.

Metal tolerance of Fusarium sp.: Results of metal tolerance of the Fusarium isolate considering MIC and TI values against different heavy metals viz., cadmium, copper, iron, nickel and zinc are depicted in Table 3. The isolate showed considerable resistance against all the tested heavy metals.

Tolerance indices of the Fusarium isolate against the heavy metals at three different concentrations (50, 100 and 150 ppm) were also tested and the results have been shown in

Effect of heavy metals on IAA and GA production of Fusarium sp.: IAA production of the isolate was completely inhibited in Cd and Ni supplemented medium. The results are presented in Table 4. Considerable amount of IAA production was noticed in presence of Cu or Fe and Zn (120-170 µg/ml).

No GA production was found in presence of Cd and Ni, although the isolate showed decent growth in medium supplemented with the corresponding heavy metals (Fig. 4; Table 4). Unaffected GA production was observed in presence of Cu or Fe or Zn (2800-3000 µg/ml).

Effect of heavy metals on siderophore production of Fusarium sp.: In spite of growth in Cd supplemented broth, it did not produce any siderophore in the medium (Fig.5; Table 5). Among the other four heavy metals, Ni affected siderophore production of Fusarium isolate to a reasonable extent (80 nmole/ml), but considerable amount of siderophore was produced in presence of Cu, Fe and Zn (400-540 nmole/ml). It is worth mentioning that iron stress in the medium was provided via application of FeSO4 which may not be inhibitory for siderophore production since siderophore can only bind to Fe3+ ion, not the Fe2+ ion.

Phosphate solubilisation under heavy metal stress: Results of phosphate solubilisation of the isolate is depicted table 6.  The isolate failed to exhibit phosphate solubilisation property in presence of Cadmium (Cd). The isolate was able to solubilise inorganic phosphate in presence of Fe, Cu, Ni and Zn to the same extent (Fig. 6).

Ammonia production: Soil microorganisms secrete ammonia to inhibit growth of other organisms. The Fusarium isolate was studied for ammonia production as its peptone water culture turned brown with the addition of Nessler’s reagent (Fig. 7;).

DISCUSSION

At comparatively lower concentrations of the metals, the tested fungal isolate was found to be resistant and exhibited noticeable growth, normally matching up to the growth of control. Higher metal concentrations caused a slight slower growth reduction. The order of tolerance shown by the isolate against the heavy metals was record as Zn>Fe=Ni=Cu>Cd.

The potential IAA-producing Fusarium isolate was characterised further in terms of their IAA production under heavy metal stressed conditions. The Fusarium isolate exhibited IAA production in variable amounts when exposed to different heavy metals (Fig. 4; Table 4). But, Cadmium (Cd) completely inhibited IAA production at minimum concentration (50 ppm). Lethal effects of Cadmium (Cd) on auxin production (IAA) was also documented by other investigators [21,22]. IAA production was also found to be completely blocked in the presence of Nickel (Ni).  IAA production by the isolate was found in the range 120-170 µg/ml in the presence of heavy metals.

Cadmium (Cd) and nickel (Ni) also posed their detrimental effects on Gibberellic acid (GA) biosynthesis of the Fusarium sp. Other heavy metals did not affect GA production.There was hardly any drop in GA synthesis when compared with the control. In presence of Cu, Fe and Zn, the GA production (2800-3000 µg/ml) was found to be matching nearly the control (3100 µg/ml).

The Fusarium isolate was also evaluated for its ability to produce the iron chelator metabolite siderophore in presence of wide variety of heavy metals in culture broth (Table 5; Fig. 5). Expectedly, Cd posed toxic effect on siderophore production of the Fusarium isolate. Ni was also found to be slightly inhibitory in siderophore production of F. solani SF0104 (80 nmole/ml). The other heavy metals did not affect siderophore production. There was no noticeable any drop in siderophore production when compared with the control. In presence of Cu, Fe and Zn, siderophore production (400-540 nmole/ml) was found to be matching with the control the control (590 nmole/ml).

The promising phosphate solubiliser F. Solani KUSF0104 was characterised with respect to its potential to solubilise phosphates under heavy metal stress (Table 6; Fig. 6). Cd completely checked the ability of the isolate to solubilize insoluble phosphates. Significantly, in the presence of the rest of the heavy metals, phosphate solubilization was found substantially on the higher range (1400- 1800 ppm). Cd concentration upto 10 µg/ml did not affect siderophore production and phosphate solubilisation ability of Ralstonia mannitolilytica KUCd7 [23].

Production of ammonia is considered as important plant growth-promoting trait since it shows inhibitory effect to control soil borne pathogens24. Moreover, in aqueous medium it forms ammonium salt which at a low concentration (20-200 μM) is absorbed by the plant 25. The Fusarium isolate was found to be a potential ammonia producer in metal-contaminated broth (Fig. 7).

CONCLUSION

The Fusarium isolate exhibited in-vitro plant growth-promoting attributes when exposed to different heavy metals such as Copper (Cu), iron (Fe), nickel (Ni) and zinc (Zn). The soil isolate demonstrated considerable auxin (IAA) production in presence of Cu (120 µg/ml), Fe (170 µg/ml), Zn (150 µg/ml); The isolate Fusarium solani SF0104 also produced GA in presence of Cu, Fe and Zn substantially. Siderophore production was found to be reasonably on the higher range (80-540 nmole/ml) in presence of wide variety of the heavy metals. Phosphate solubilization was found to be nearly matching with that of control in presence of all the tested heavy metals except cadmium (Cd). In addition, ammonia production by the soil isolate was also satisfactory in the presence of different heavy metals.

Thus, it can be inferred that the Fusarium isolate has the potential for growth in a wide range of cultural conditions in the presence of heavy metals and it could be exploited for growth promotion of a number of crop plants in field conditions, as revealed by several plant growth-promoting attributes of the fungus, even when exposed to wide variety of heavy metals.

REFERENCES

[1]. Nies, D. H. (1999). Microbial heavy-metal resistance. Applied microbiology and biotechnology, 51(6), 730-750.

[2]. Gadd, G. M. (2007). Fungi and industrial pollutants. The mycota, 4, 68-84.

[3]. Iram, S., Ahmad, I., Javed, B., Yaqoob, S., Akhtar, K., Kazmi, M. R., & Rand Zaman, B. (2009). Fungal tolerance to heavy metals. Pak J Bot, 41(5), 2583-2594.

[4]. Hyakumachi, M. (1994). Plant-growth-promoting fungi from turfgrass rhizosphere with potential for disease suppression. Soil Microorganisms, 44, 53-68.

[5]. Leitao, A. L., & Enguita, F. J. (2016). Gibberellins in Penicillium strains: challenges for endophyte-plant host interactions under salinity stress. Microbiological research, 183, 8-18.

[6]. Sasirekha, B., & Srividya, S. (2016). Siderophore production by Pseudomonas aeruginosa FP6, a biocontrol strain for Rhizoctonia solani and Colletotrichum gloeosporioides causing diseases in chilli. Agriculture and Natural Resources, 50(4), 250-256.

[7]. Tsavkelova, E., Oeser, B., Oren-Young, L., Israeli, M., Sasson, Y., Tudzynski, B., & Sharon, A. (2012). Identification and functional characterization of indole-3-acetamide-mediated IAA biosynthesis in plant-associated Fusarium species. Fungal Genetics and Biology, 49(1), 48-57.

[8]. Joo, G. J., Kim, Y. M., Kim, J. T., Rhee, I. K., Kim, J. H., & Lee, I. J. (2005). Gibberellins-producing rhizobacteria increase endogenous gibberellins content and promote growth of red peppers. The Journal of Microbiology, 43(6), 510-515.

[9]. Bhattacharya, A., Kourmpetli, S., Ward, D. A., Thomas, S. G., Gong, F., Powers, S. J., & Phillips, A. L. (2012). Characterization of the fungal gibberellin desaturase as a 2-oxoglutarate-dependent dioxygenase and its utilization for enhancing plant growth. Plant physiology, 160(2), 837-845.

[10]. Srivastava, A. C., Agarwal, D. K., & Sarbhoy, K. (2003). Screening of potential gibberellin producing Fusarium strains for the hybrid rice production. Journal of Food, Agriculture and Environment 1, 250–253.

[11]. Zainudin, N. A. I. M., Razak, A. A., & Salleh, B. (2008). Secondary metabolite profiles and mating populations of Fusarium species in section Liseola associated with bakanae disease of rice. Malaysian J. Microbiol, 4, 6-13.

[12]. Bhalla, K., Singh, S. B., & Agarwal, R. (2010). Quantitative determination of gibberellins by high performance liquid chromatography from various gibberellins producing Fusarium strains. Environmental monitoring and assessment, 167(1-4), 515-520.

[13]. Neilands, J. B. (1981). Iron absorption and transport in microorganisms. Annual review of nutrition, 1(1), 27-46

[14]. Vassilev, N., Medina, A., Azcon, R., & Vassileva, M. (2006). Microbial solubilization of rock phosphate on media containing agro-industrial wastes and effect of the resulting products on plant growth and P uptake. Plant and Soil, 287(1-2), 77.

[15]. Bishop, M. L., Chang, A. C., & Lee, R. W. K. (1994). Enzymatic mineralization of organic phosphorus in a volcanic soil in Chile. Soil Science, 157(4), 238-243.

[16]. Akintokun, A. K., Akande, G. A., Akintokun, P. O., Popoola, T. O. S., & Babalola, A. O. (2007). Solubilization of insoluble phosphate by organic acid-producing fungi isolated from Nigerian soil. International Journal of Soil Sciences, 2(4), 301-307.

[17]. White, TJ., Bruns, T., Lee, S., Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, MA, Gelfand DH, Sninsky JJ, White TJ, (eds) PCR Protocols: A Guide to Methods and Applications, Academic Press, Inc., New York, pp. 315-322.

[18]. Zafar, S., Aqil, F., & Ahmad, I. (2007). Metal tolerance and biosorption potential of filamentous fungi isolated from metal contaminated agricultural soil. Bioresource technology, 98(13), 2557-2561.

[19]. Ezzouhri, L., Castro, E., Moya, M., Espinola, F., & Lairini, K. (2009). Heavy metal tolerance of filamentous fungi isolated from polluted sites in Tangier, Morocco. African journal of microbiology research, 3(2), 35-48.

[20]. Cappucino, J. C., & Sherman, N. (1992). Nitrogen cycle. Microbiology: a laboratory manual, 4th edn. Benjamin/Cumming, New York, 311-312.

[21]. Singh, R., Pathak, B., &Fulekar, M. H. (2015). Characterization of PGP traits by heavy metals tolerant Pseudomonas putida and Bacillus safensis strain isolated from rhizospheric zone of weed (Phyllanthus urinaria) and its efficiency in Cd and Pb removal. Int J Curr Microbiol Appl Sci, 4(7), 954-975.

[22]. Paul, A., & Datta, B. (2017). Characterization of cadmium bioremediation and plant growth promoting activities of Leucobacter sp. KUCd3 isolated from industrial belt of Kalyani, West Bengal, India, European Journal of Biomedical and Pharmaceutical Sciences, 4(9), 552-565.

[23]. Paul, A., & Datta, B. (2016). Cadmium-resistant Ralstonia mannitolilytica Relieved Cadmium Toxicity in Mustard Plant Through Root Colonization and Growth Promoting Activity. Research Journal of Microbiology, 11(6), 157-168.

[24]. Baligh, M., Conway, K. E., & Delgado, M. A. (1996). Production of ammonia by Pseudomonas cepacia and Pseudomonas aeruginosa: Quantification and effect on host and pathogen. Recent research developments in plant pathology, 1, 19.

[25]. Ludewig, U., Neuhäuser, B., & Dynowski, M. (2007). Molecular mechanisms of ammonium transport and accumulation in plants. FEBS letters, 581(12), 2301-2308.